The graph compares the enzyme concentration (y-axis) versus the average absorbance (x-axis) for the enzyme inhibition assay test on PSTP. The enzyme inhibition assay test was not successful. For the enzyme inhibition assay, as the enzyme concentration increase, the absorbance, measured with the spectrophotometer, was supposed to decrease. From the 9 tubes tested, the first tube only had an absorbance; the rest of the tubes had an absorbance of 0. The absorbance levels for Run 1 and Run 2 were zero. This could have been caused by the enzyme, PSTP, not being fully active.
The graph below compares the enzyme concentration (y-axis) versus the average Absorbance (x-axis) for the enzyme assay test on PSTP. The enzyme assay test was not successful. For the enzyme assay, as the enzyme concentration increased, the Absorbance, measured with the spectrophotometer, was supposed to also increase. The Absorbance in the graph fluctuated; the Absorbance kept decreasing and increasing. The first sample that did not contain any enzyme had the highest concentration, which was probably cause by pipette contamination
List of the top 10 ligands ranked from the highest to lowest fitness score for the Cb_306_3d.sdf library. The table displays the polar contacts and shows if each ligand violates or passes the Lipinski’s Rule of Five. The table displays the ligand name, PLP score, S(hbond) as the distance dependent hydrogen, S(cho) as the angle-dependent hydrogen and S(metal) as the metal bonding, DE(clash) as the heavy-atom clash potential, and the DE(tors) as the torsional potential.
Week 14 (November 26-30, 2012)
After Protein Expression and Purification, the protein, PSTP, was characterized. The gel shown below contains some bands that are strong and some that are weak. The image shown below is before the drying drying process.
PSTP protein gel Lane 1: Skip Lane 2: NEB Protein Ladder Lane 3: Sample 0 (Pre-Induction) Lane 4: Sample 1 (Post Induction) Lane 5: Sample 2 (Soluble Fraction) Lane 6: Sample 3 (Flow through) Lane 7: Sample 4 (Wash) Lane 8: Sample 5 (Elution 1) Lane 9: Sample 6 (Elutiion 2) Lane 10: empty
The table shown below is the Overall Top 10 ligands from the all the output files of GOLD 2nd run in the Cb_306_3d.sdf library for the Homology model, 1ywf for the Protein Tyrosine Phosphatase target.
After sonication, the samples of elution 1 and 2 were saved. The samples were nanodropped and then concentrations were Elution 1: 0.50mg/ml and Elution 2: 0.07mg/ml. Both graphs contains one peak which means that each sample did not contain many contaminations.
PSTP- Elution 1: 0.50mg/ml
PSTP- Elution 2: 0.07mg/ml
Week 13 (November 19-23, 2012)
112612 - ?? Dr B The virtual screening results for my Protein Tyrosine Phosphatase homology model had an error and did not contain any ligands. We the run was reran, another error occurred; instead of having the top 31 ligands, the file contained 506 ligands. In order to fix the issue, the gold.conf and scriptgoldscanthisjob document had to be reviewed in order to make a table in excel with the best ranking ligands.
Week 12 (November 12, -16, 2012)
Ivy - ok, show some type of 'Data'. - Dr. B 11/19/12 Virtual Screening on Protein Tyrosine Phosphatase Homology model
The first run was killed due to slowness of the system
The first run was reran again on 11/16/2012 at 4:00 pm
Protein Expression for the PSTP enzyme
Day 2: colonies from the BL21(DE3) cells were grown in LB, manganese and Kan and was incubated overnight for approximately 16 hours
Day 3: 10 ml of the solution from day 2 was added to a fresh 500 ml of LB and the cell density was checked and the solution from day 2 was added until it reached an OD of 0.1.Then the OD was checked until it reached 0.5. IPTG was added to start protein expression. Next it was grown on shaker for 18 hours.
Day 4: after being harvested for 18 hours, the solution was spun downed in the 1st floor room centrifuge. the pellet weighed approximately 3.93 grams. The pellet was saved in the -80oC freezer.
Day 5: The pellet was re-suspended in Lysis Buffer and TCEP and then it was sonicated in the sonication machine. Next, it was stored in the -20oC freezer.
Week 11 (November 5, -10, 2012)
If cloning fails, we will use MtPSTP as surrogate next week.
A gel check was done on the pNIC-Bsa4 accepting vector. Lane 3 and 5 shows that the accepting vector has two cuts.
Ivy Nwogu and Jennifer R.
pNIC-Bsa4 Accepting Vector
Lane 1: Empty
Lane 2: 100bp Ladder
Lane 3: pNIC-Bsa4 accepting vector - Ivy
Lane 4: Empty
Lane 5: pNIC-Bsa4 accepting vector - Jennifer
pNIC-BSA4 Accepting vector was prepared. PCR-clean up and nanodrop was done on the accepting accepting to determine the concentration.
Week 10 (October 29 - Nov 2, 2012)
Virtual Screening for the Target Protein-Tyrosine-Phosphatase was ran with the homology model
Another gel check was done for PCR Square because the last gel did not show the results accurately. I made some more Secondary PCR for Stephanie because it failed and did not show on the gel on lanes 3 and 4.
Ivy Nwogu
PCR Square/Secondary PCR
Lane 1: Empty
Lane 2: 100bp Ladder
Lane 3: Secondary 1
Lane 4: Secondary 2
Lane 5: PCR Square
Lane 6: PCR Square (Same sample as Lane 5)
My Protein-Tyrosine-Phosphatase did not have a crystal structure, a homology model was found and showed below . Template : 1ywf
Stephanie and I were having issues with the Gel Rig. It kept turning off and on and wasn't working properly, that's why the solution in the wells are not further down. In Lane 3 there was a strong band present at roughly at 790bp. In lane 5, it shows a little contamination but it does show a strong band at approximately 790bp.
Ivy Nwogu & Stephanie B.
PCR Square/PCR Clean-up
Lane 1: Empty
Lane 2: 100Bp Ladder
Lane 3: PCR Square - Ivy
Lane 4: Empty
Lane 5: PCR Square - Stephanie
8 tubes were produced from PCR Square, the PCR Clean-Up was done on the 8 tubes combined and then the solution was nanodrop and concentration results are shown below.
The concentration above is a pretty good concentration. Next is to perform a gel on the PCR square solution to make sure there is a limited amount of contamination.
Week 9 (October 22-26, 2012)
Next, Transformation of Competent cells for Plasmid of pNIC-Bsa4 were made. 16 pellets were stored under VDS Staff in the -20 freezer
Then I added tube 1, 2, and 4 together and did another Nano-drop in the three tube combined to determine the concentration. Tube 3 was saved in -20 freezer.
Figure 5: The concentration of tubes 1, 2, and 4 combined was 70.9ng/ul
After PCR clean up, the four tubes were nano drop to determine the concentration. results are shown below
Week 8 (October 15-19, 2012)
102112- Ivy - nice job! You can let Stephanie and Jennifer use some of your secondary - so that they can try the PCR squared step. Also, let me know how the pNIC-Bsa4 preparation goes this week. -- Dr. B
Next I started my PCR Squared Reaction. 4 tubes were produced for the PCR square, then I used the sigma PCR clean-up kit in the red box. A mistake made was that I did not combine my 4 tubes into one tube before being the PCR clean-up. It is predicted that I will receive low concentration results when I nano-drop this upcoming week.
A 2nd trial of the primary and Secondary PCR was done again because during the first trial of the primary and secondary PCR, I added blue loading dye to the entire 2 PCR tubes. So I did not have any Primary and Secondary PCR solutions to use for the next step. Below shows two Gels which were successful.
Ivy Nwogu
Primer YpPTPfor and YpPTPrev
Lane 1: Empty
Lane 2: 1kb Ladder
Lane 3: Secondary PCR
Lane 4: Secondary PCR
Lane 5: 1kb Ladder During the 2nd trial of the Secondary PCR, Lane 3 and 4 shows the secondary PCR with a strong distinct band and the gene size at 1,5 kb . The 2nd trial Secondary PCR was Successful.
Ivy Nwogu Primer YpPTPfor and YpPTPrev Lane 1: Empty Lane 2: 1kb Ladder Lane 3: Primary PCR
The 2nd trial of the Primary PCR gel shows that the gene was smeared and did not have a distinctive band. The 2nd trial of primary PCR was Successful.
Week 7 (October 8-12, 2012)
101612 - Ivy - great job on the PCR's!. The VS results look good. Did you change the default scoring to the old Gold Fitness instead of the PLP score? -- Dr. B
Next my virtual screening refresher was completed. The results are uploaded into the VDSClass Google docs, The table below shows the Overall Top 10 ligands from the all the output files of GOLD 2nd run.
I completed the primary and secondary PCR for my target, Protein-Tyrosine Kinase. A gel check was done to [[#|confirm]] the primary and secondary PCR solutions worked. The Gel image is shown below. Lane 3 shows a smear substance of the primary PCR and the secondary PCR has a strong distinct band, the gene size is approximately 1.5 Kb.
Ivy Nwogu
Primary and Seconday PCR Gel Check
Primer: YpPTPfor and YpPTPrev
Lane 1: Empty
Lane 2: 1kb Ladder
Lane 3: Primary PCR
Lane 4: Secondary PCR
Week 6 (Oct. 1-5, 2012)
100912 - Ivy, ok - any visual results from this week? gels etc.. Dr. B
Oligo Mix was made and stored in the -20 freezer. Primary PCR will be done the following Monday of next week .
Week 5 (Sept 24-29, 2012)
Ivy - your 1st PCR is actually ok. You just didn't have amplification in that one lane. Good enough for 1st PCR. You have also attempted 2nd PCR. - which is all I really want you to do for that one. It actually doesn't work that well. You are ok to move on to your Cloning and making yoru Oligo mix.
You are missing your Tail primer design though. I don't see it here, on the target page or in your Google Docs.
-- Dr. B 093012
2nd PCR Run
Secondary PCR- pNIC-Bsa4 Lane 1: blank Lane 2: Sample A Lane 3: Sample B Lane 4: Sample C Lane 5: Sample D (no DNA)
My second PCR was a disaster. None of the wells were visible possibly due to contamination, mistakes in the procedure or the PCR solutions not fully reacting with the plasmid. The PCR will have to be done again.
PyMOLRefresher was completed this week. The full report can be found in my VDS Lab notebook. There were four many molecules, which is shown below.
Results from 1st PCR Run
Purple Protein pGBR22 Plasmid Lane 1: Empty Lane 2: 100 bp Ladder Lane 3: Sample A Lane 4: Sample B Lane 5: Sample C Lane 6: Sample D- No DNA
The gel shown above was not fully successful. Lane 3 was supposed to have bands because it contained DNA plasmid but there were no bands possibly due to contamination or it was not amplified correctly. Since there were some bands missing, the PCR was not successful; this could be caused by mistakes made during the procedures.
Week 4 (Sept. 17-21,2012)
Ivy - ok good luck on the next round of Midiprep. Move forward with your PCR's though first.
Also - in Week 3 - your image of RE digest is actually a PCR gel image. Is that yours or was there a mix-up with the files? -- Dr. B
1st PCR Run:
The purpose of the PCR Run is to amplify Purple Protein coding sequence in the pGBR22 plasmid using the M13 Forward and M13 Reverse Primers. Four tubes had the same concentration of ThermoPol Buffer NEB, M13 Forward and Reverse Primer, DNTP, and diluted Taq DNA Polymerase NEB, with different amounts of plasmid and DDW.
After it was ran in the PCR machine, the tubes were stored in the -20oc freezer. For the next step of the gel process.
Midi-Prep Kit- HiSpeed:
The Plasmid HiSpeed Midi Kit was used to extract DNA from transformed cells. Many Buffers such as Buffer P2 and P3 were used to extract the DNA bacterial cells. After the DNA bacterial cells were purified, Nanodrop was used to determine approximately the concentration of DNA. The first time I did Midi-Prep, my Nanodrop results were very low. The concentration was 1.8ng/uL. This was possibly due to contamination and possible over purifying. I did a second round of Midi-Prep to gather more accurate information on the purified bacterial cells. The second results were also very low. The concentration was at 1.7ng/uL. The concentration was probably low because of contamination and the plasmid may have not been properly grown when incubated.
Figure 1: First Run of Nanodrop graph of concentration of DNA Wavelength at 260 nm. Concentration: 1.8 ng/uL
Figure 2: Second Run of Nanodrop graph of concentration of DNA Wavelength at 260 nm. Concentration: 1.7ng/uL
Week 3 (Sept. 10-14, 2012)
Ivy - ok, great job on the pics and updating. For your gel - you can use the caption style like some of the others have on theirs (see Sumans or Divya) - it makes it easier to read fast. You are doing it the correct way for a publication - but for the Wiki we can just make it easier. Also, you don't need to include as much protocol detailed steps (since that is in your notebook) - use that space instead for analysis of the results. In particular - can you talk about what is going on with your RE digest?? -- Thanks, Dr.B 091812
Restriction Enzyme Digest (September 13, 2012)
During this experiment, the pGBR22 plasmid was used to perform a Restriction Enyzme Digest. An agarose gel was run using EcoRI, our plasmid, and PvuII. The Gel is shown below with each lane stating what it contains in it. The bands that are darker in color are further up in the lane, and the bands that are lighter are further down in the lane. The image of the gel is shown below.
Figure 1:pGBR22 DNA First lane does not contain any solution Second lane contains the 1 Kb Ladder Third lane contains uncut pNIC-Bsa4 plasmid Fourth lane contains EcoRI Fifth lane contains PvuII Sixth lane contain EcoRI and PvuII .
Transformation of Competent cells for Plasmid of pNIC-Bsa4
Day 3 (September 12, 2012): After it was grown overnight, my solution was cloudy. My LB media was poured into four labeled 50ml conical tube and balanced using Nanopure water if necessary. It was spun down in the centrifuge for 15 mins and the waste was disposed in the waste container. The pellets were left in the conical tubes and placed in the -20oC freezer for storage
.
Figure 1: Four 50ml Conical tubes containing the pNIC-Bsa4 + LB +Kan, DH5-alpha pellets.
Day 2: After overnight incubation, my agar plate with E. DH5-alpha bacteria was used for Day 2 experiment because it was contaminated. Instead I used a colony from Stephanie B.'s DH5-alpha bacteria plate. After the flask was prepared, it was placed into the shaking incubator for overnight incubation.
Figure 1 and 2: My Contaminated Agar plate containing DH5-alpha bacteria.
Week 2 (Sept. 3-7, 2012)
Analyzing DNA Sequence (September 7, 2012)
In the computer lab, we analyzed DNA Sequences. We analyzed the purple corral protein, pGBR22, we experimented on last year [[#|semester]]. The reason why we used the same protein was to be able to learn how to analyze the data before we analyze are target protein in the future. In conclusion, we made a visible gel through the computer that will be similar to the wet lab during REdigest. The pictures below show the 1kb ladder, and the bands for the enzymes ecoRI, PuvII, and EcoRI and PvuII together.
Transformation of Competent cells for Plasmid of pNIC-Bsa4
Day 1 : There was two agar plates prepared and placed in the incubator overnight. One of the agar plates was the control and did not contain any DNA.The other agar plate contained E.Coli DH5-alpha bacteria.
Primer Dilutions
We practice diluting primers with the ones that were I used the pLIC forward. Since I worked individually on this particular lab, I used one of my classmates pLIC Reverse.The TE and stock solutions were calculated and the ending products of the Stock solutions and working Dilutions were stored in the freezer.
Week 1(August 27-31, 2012) I researched on the organism, Yersinia enterocolitica. This organism is an infectious disease caused by a bacterium. A potential and possibly a good candidate for a target on this organism is Protein Tyrosine Phosphatase. This semester's research will be mainly focused on this target protein and how it will react in potential experiments. An image of my protein is shown below.
The enzyme inhibition assay test was not successful. For the enzyme inhibition assay, as the enzyme concentration increase, the absorbance, measured with the spectrophotometer, was supposed to decrease. From the 9 tubes tested, the first tube only had an absorbance; the rest of the tubes had an absorbance of 0. The absorbance levels for Run 1 and Run 2 were zero. This could have been caused by the enzyme, PSTP, not being fully active.
The enzyme assay test was not successful. For the enzyme assay, as the enzyme concentration increased, the Absorbance, measured with the spectrophotometer, was supposed to also increase. The Absorbance in the graph fluctuated; the Absorbance kept decreasing and increasing. The first sample that did not contain any enzyme had the highest concentration, which was probably cause by pipette contamination
Week 14 (November 26-30, 2012)
PSTP protein gel
Lane 1: Skip
Lane 2: NEB Protein Ladder
Lane 3: Sample 0 (Pre-Induction)
Lane 4: Sample 1 (Post Induction)
Lane 5: Sample 2 (Soluble Fraction)
Lane 6: Sample 3 (Flow through)
Lane 7: Sample 4 (Wash)
Lane 8: Sample 5 (Elution 1)
Lane 9: Sample 6 (Elutiion 2)
Lane 10: empty
Week 13 (November 19-23, 2012)
112612 - ?? Dr B
The virtual screening results for my Protein Tyrosine Phosphatase homology model had an error and did not contain any ligands. We the run was reran, another error occurred; instead of having the top 31 ligands, the file contained 506 ligands. In order to fix the issue, the gold.conf and scriptgoldscanthisjob document had to be reviewed in order to make a table in excel with the best ranking ligands.
Week 12 (November 12, -16, 2012)
Ivy - ok, show some type of 'Data'. - Dr. B 11/19/12
Virtual Screening on Protein Tyrosine Phosphatase Homology model
Protein Expression for the PSTP enzyme
Week 11 (November 5, -10, 2012)
Ivy Nwogu and Jennifer R.
pNIC-Bsa4 Accepting Vector
Lane 1: Empty
Lane 2: 100bp Ladder
Lane 3: pNIC-Bsa4 accepting vector - Ivy
Lane 4: Empty
Lane 5: pNIC-Bsa4 accepting vector - Jennifer
Week 10 (October 29 - Nov 2, 2012)
Ivy Nwogu
PCR Square/Secondary PCR
Lane 1: Empty
Lane 2: 100bp Ladder
Lane 3: Secondary 1
Lane 4: Secondary 2
Lane 5: PCR Square
Lane 6: PCR Square (Same sample as Lane 5)
Ivy Nwogu & Stephanie B.
PCR Square/PCR Clean-up
Lane 1: Empty
Lane 2: 100Bp Ladder
Lane 3: PCR Square - Ivy
Lane 4: Empty
Lane 5: PCR Square - Stephanie
The concentration above is a pretty good concentration. Next is to perform a gel on the PCR square solution to make sure there is a limited amount of contamination.
Week 9 (October 22-26, 2012)
Next, Transformation of Competent cells for Plasmid of pNIC-Bsa4 were made. 16 pellets were stored under VDS Staff in the -20 freezer
Then I added tube 1, 2, and 4 together and did another Nano-drop in the three tube combined to determine the concentration. Tube 3 was saved in -20 freezer.
After PCR clean up, the four tubes were nano drop to determine the concentration. results are shown below
Week 8 (October 15-19, 2012)
102112- Ivy - nice job! You can let Stephanie and Jennifer use some of your secondary - so that they can try the PCR squared step. Also, let me know how the pNIC-Bsa4 preparation goes this week. -- Dr. B
Next I started my PCR Squared Reaction. 4 tubes were produced for the PCR square, then I used the sigma PCR clean-up kit in the red box. A mistake made was that I did not combine my 4 tubes into one tube before being the PCR clean-up. It is predicted that I will receive low concentration results when I nano-drop this upcoming week.
A 2nd trial of the primary and Secondary PCR was done again because during the first trial of the primary and secondary PCR, I added blue loading dye to the entire 2 PCR tubes. So I did not have any Primary and Secondary PCR solutions to use for the next step. Below shows two Gels which were successful.
Ivy Nwogu
Primer YpPTPfor and YpPTPrev
Lane 1: Empty
Lane 2: 1kb Ladder
Lane 3: Secondary PCR
Lane 4: Secondary PCR
Lane 5: 1kb Ladder
During the 2nd trial of the Secondary PCR, Lane 3 and 4 shows the secondary PCR with a strong distinct band and the gene size at 1,5 kb . The 2nd trial Secondary PCR was Successful.
Ivy Nwogu
Primer YpPTPfor and YpPTPrev
Lane 1: Empty
Lane 2: 1kb Ladder
Lane 3: Primary PCR
The 2nd trial of the Primary PCR gel shows that the gene was smeared and did not have a distinctive band. The 2nd trial of primary PCR was Successful.
Week 7 (October 8-12, 2012)
101612 - Ivy - great job on the PCR's!. The VS results look good. Did you change the default scoring to the old Gold Fitness instead of the PLP score? -- Dr. B
Next my virtual screening refresher was completed. The results are uploaded into the VDSClass Google docs, The table below shows the Overall Top 10 ligands from the all the output files of GOLD 2nd run.
I completed the primary and secondary PCR for my target, Protein-Tyrosine Kinase. A gel check was done to [[#|confirm]] the primary and secondary PCR solutions worked. The Gel image is shown below. Lane 3 shows a smear substance of the primary PCR and the secondary PCR has a strong distinct band, the gene size is approximately 1.5 Kb.
Ivy Nwogu
Primary and Seconday PCR Gel Check
Primer: YpPTPfor and YpPTPrev
Lane 1: Empty
Lane 2: 1kb Ladder
Lane 3: Primary PCR
Lane 4: Secondary PCR
Week 6 (Oct. 1-5, 2012)
100912 - Ivy, ok - any visual results from this week? gels etc.. Dr. B
Oligo Mix was made and stored in the -20 freezer. Primary PCR will be done the following Monday of next week .
NOTE !
PCRPrimerDesignforpNICBsa4-Cloning
Forward Primer: TACTTCCAATCCATGATGACCACCTCTGCGCTC
Reverse Primer: TATCCACCTTTACTGTAATTTCCTGGAATAAGG
Reverse compliment of Tail: CAGTAAAGGTGGATA
Week 5 (Sept 24-29, 2012)
Ivy - your 1st PCR is actually ok. You just didn't have amplification in that one lane. Good enough for 1st PCR. You have also attempted 2nd PCR. - which is all I really want you to do for that one. It actually doesn't work that well. You are ok to move on to your Cloning and making yoru Oligo mix.
You are missing your Tail primer design though. I don't see it here, on the target page or in your Google Docs.
-- Dr. B 093012
My second PCR was a disaster. None of the wells were visible possibly due to contamination, mistakes in the procedure or the PCR solutions not fully reacting with the plasmid. The PCR will have to be done again.
The gel shown above was not fully successful. Lane 3 was supposed to have bands because it contained DNA plasmid but there were no bands possibly due to contamination or it was not amplified correctly. Since there were some bands missing, the PCR was not successful; this could be caused by mistakes made during the procedures.
Week 4 (Sept. 17-21,2012)
Ivy - ok good luck on the next round of Midiprep. Move forward with your PCR's though first.
Also - in Week 3 - your image of RE digest is actually a PCR gel image. Is that yours or was there a mix-up with the files? -- Dr. B
1st PCR Run:
- The purpose of the PCR Run is to amplify Purple Protein coding sequence in the pGBR22 plasmid using the M13 Forward and M13 Reverse Primers. Four tubes had the same concentration of ThermoPol Buffer NEB, M13 Forward and Reverse Primer, DNTP, and diluted Taq DNA Polymerase NEB, with different amounts of plasmid and DDW.
Midi-Prep Kit- HiSpeed:After it was ran in the PCR machine, the tubes were stored in the -20oc freezer. For the next step of the gel process.
Week 3 (Sept. 10-14, 2012)
Ivy - ok, great job on the pics and updating. For your gel - you can use the caption style like some of the others have on theirs (see Sumans or Divya) - it makes it easier to read fast. You are doing it the correct way for a publication - but for the Wiki we can just make it easier. Also, you don't need to include as much protocol detailed steps (since that is in your notebook) - use that space instead for analysis of the results. In particular - can you talk about what is going on with your RE digest?? -- Thanks, Dr.B 091812
Restriction Enzyme Digest (September 13, 2012)
- During this experiment, the pGBR22 plasmid was used to perform a Restriction Enyzme Digest. An agarose gel was run using EcoRI, our plasmid, and PvuII. The Gel is shown below with each lane stating what it contains in it. The bands that are darker in color are further up in the lane, and the bands that are lighter are further down in the lane. The image of the gel is shown below.
Figure 1:pGBR22 DNAFirst lane does not contain any solution
Second lane contains the 1 Kb Ladder
Third lane contains uncut pNIC-Bsa4 plasmid
Fourth lane contains EcoRI
Fifth lane contains PvuII
Sixth lane contain EcoRI and PvuII .
Transformation of Competent cells for Plasmid of pNIC-Bsa4
- Day 3 (September 12, 2012): After it was grown overnight, my solution was cloudy. My LB media was poured into four labeled 50ml conical tube and balanced using Nanopure water if necessary. It was spun down in the centrifuge for 15 mins and the waste was disposed in the waste container. The pellets were left in the conical tubes and placed in the -20oC freezer for storage
.Figure 1: Four 50ml Conical tubes containing the pNIC-Bsa4 + LB +Kan, DH5-alpha pellets.
Figure 1 and 2: My Contaminated Agar plate containing DH5-alpha bacteria.
Week 2 (Sept. 3-7, 2012)
Analyzing DNA Sequence (September 7, 2012)
- In the computer lab, we analyzed DNA Sequences. We analyzed the purple corral protein, pGBR22, we experimented on last year [[#|semester]]. The reason why we used the same protein was to be able to learn how to analyze the data before we analyze are target protein in the future. In conclusion, we made a visible gel through the computer that will be similar to the wet lab during REdigest. The pictures below show the 1kb ladder, and the bands for the enzymes ecoRI, PuvII, and EcoRI and PvuII together.
Transformation of Competent cells for Plasmid of pNIC-Bsa4Primer Dilutions
Week 1(August 27-31, 2012)
I researched on the organism, Yersinia enterocolitica. This organism is an infectious disease caused by a bacterium. A potential and possibly a good candidate for a target on this organism is Protein Tyrosine Phosphatase. This semester's research will be mainly focused on this target protein and how it will react in potential experiments. An image of my protein is shown below.